fffddadd8631 fffddadd8631

15-03-2018
Biology

contestada

What biome has scattered clumps of trees and seasonal rains?

Respuesta :

JonHenderson55 JonHenderson55

15-03-2018

Answer: the "savanna" .
___________________________________________________

Answer Link

Otras preguntas

PART 1: IDENTIFY YOUR TARGET POPULATION?

Solve 2y - 5x = -2 3y + 2x = 35 using elimination

How many sharps and flats are in the relative scales E flat major and c minor?

Which of these does the psychopath typically lack? a. Empathy b. Remorse c. Anxiety d. All of the above

Expand(x+y) ⁴ ×(x+y) (x+y) (x+y) (x+y) 2⁴.

Replicate the following gene strand, and then transcribe the template strand:GTTAATGGCCATGATGGCTTTGTGATTAAGC .Translate the mRNA from above using single letter

Which of the following statements about the purpose of casta painting is true? a.) its purpose was simply to document scenes from daily life in the spanish new

Sudan Co. issued a $500,000, 10-year bond dated January 1, 2023. The bond was sold to yield 14% effective interest. The bond pays 12% interest on January 1 and

As a doctor investigating a mutation causing a birth defect resulting in 100% death before birth (s=1), what do you think is most likely to be driving the persi

A 2-Element Windkessel model is often employed to model blood flow in the cardiovascular system. This is the simplest of models that are used, whereby flow resi