pinktigerpop70701 pinktigerpop70701

13-03-2024
Biology

contestada

Replicate the following gene strand, and then transcribe the template strand:
GTTAATGGCCATGATGGCTTTGTGATTAAGC .Translate the mRNA from above using single letter abbreviations for the amino acids
(if you do it correctly it should spell something).

Respuesta :

Otras preguntas

Xml is used to format the structure and style of a web page. true or false

Please help me on number 31 please I beg you

SOMEONE PLEASEEEEEEE HELP ME ASAP!!!!!!!!!!

The euglena is an example of a _________________ organism.

What tool is used to measure the outside temperature? A. thermometer B. barometer C. wind vane D. hygrometer

Ms.Yen works 10 months of 12 each year. Give two fractions that represent the fraction a year she works.

Approximately what is the mass of the average adult in kilograms?

Why were the compounds of carbon originally called organic compounds?

The Council of Trent was a series of meetings held over an eighteen-year period beginning in 1545. Which statement BEST describes the work of the Council?

Do you think the three branches of government share their power equally? Explain your answer