johannatrejo62 johannatrejo62

14-12-2020
Mathematics

contestada

I don’t get this question at all. Please help meeeeee!

I dont get this question at all Please help meeeeee class=

Respuesta :

salwabaki0017 salwabaki0017

14-12-2020

Answer:7/25

Step-by-step explanation:

sin(A)=BC/AC

=14/50

=7/25

Answer Link

zachhilyer17 zachhilyer17

14-12-2020

Answer:

7/25 is the answer its a^2 + b^2 + "^2

Answer Link

Otras preguntas

I just wanna thank the good peoples on here that helped me and other people w our questions, especially math questions, because math is hard and if you take the

What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

2 -6x + 5y = 1 6x + 4y = -10

The legs of a right triangle measure 8 inches and 12 inches. What is the area of the triangle? A. 192 sq. inches B. 24 sq. inches C. 48 sq. inches D. 96 sq. inc

In 1883 who was responsible for creating 5he first system of time zones in the United state?

The reaction between iron(II) oxide and carbon monoxide produces iron and carbon dioxide. How many moles of iron can be obtained when 1.50 mol FeO reacts with a

Most of the artwork in England was produced to ? a. honor the family b. give as gifts C. keep family records Please select the best answer from the choices prov

is the point (20,13) on this line?

Marcos found a challenge involving square roots knowing that he solved correctly the answer given by marcos √81 + √49 -√100 a) 1 b) 2 c) 3 d) 4 e) 5

What is the primary function of vesicles? A. To make proteins B. To make energy (ATP) C. To make the rough ER rougher D. To transport proteins and other substan