ricorico01 ricorico01

11-11-2020
Biology

contestada

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Respuesta :

stefftagalilong stefftagalilong

19-11-2020

Answer:

what I don't understand what is the Ctcagt

Answer Link

Otras preguntas

Sam divided A rectangle into 8 congruent rectangles that each have the area shown. what is tge area of tge rectangle befoe sam divided it

a ballon is released from the top of a platform that is 50 meters tall

factor out the coefficient of the variable: 3/8d + 3/4

Lia, Phil and cam raised to $200.30.phil made 12.80 more than lia and cam made 3 time as much as lia. How much did each person made

misty bought 3 cd's.the country music cd cost $12.the roc cd cost 2/3 as much as the country music.the platinum edition cd cost twice as much as the rock cd. wh

Teresa spends 1/3 of her day at school . she spends 1/12 of her day eating meals .What is the total part of the day that Teresa spends at school and eating

how to solve (-y^2+2y^3+25)/(y-3) using long division

Which structural characteristic is found in both prokaryotic cells and eukaryotic cells? A. a cell membrane B. circular DNA C. a nucleus D. lysosomes

RATIOS Pat's Flower shop sells 2 daisies for 1.50 a) How much would 7 daisies cost? b) How many daisies can you get with 8.25?

eight friends share 12 pies equally. how many pies does each friend get?