angelgarcia98 angelgarcia98
  • 13-09-2020
  • Mathematics
contestada

Please help I have this due by tomorrow

Please help I have this due by tomorrow class=

Respuesta :

Henrick Henrick
  • 13-09-2020

Answer:

1) Linear Pair

2) Adjacent

3) Complmentary

4) Vertical

Answer Link

Otras preguntas

Can anyone help me out with my Math homework plz and also can you provide step by step explanation of the attachment I will give you 20 points:
Five times the sum of a number and 27 is greater than or equal to six times the sum of that number and 26. What is the solution set of this problem?a. (♾,-21)
10m^2-20m+48=0 solve by completing the square please show your work please.
Which ordered pair is a solution of the equation? 5x−2y=18
simplify the expression 4x24
50pesos de 100 cuánto es el porciento​
The Portuguese colonisation was the most brutal form of colonisation in the Arabian Gulf region. Explain.
How do you find the ordered pair of this equation? 2x-2=y​
What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
WORTH 15 POINTS!!!!!! When you park facing downhill and there is a curb, turn your wheels _____ the curb. When you park facing uphill and there is a curb, turn