sadiabhuiyan sadiabhuiyan

11-02-2019
English

contestada

In this excerpt from his speech, what is one technique Dr. King uses to appeal to his audience?

Respuesta :

deluxenite11 deluxenite11

11-02-2019

do you have the excerpt from his speech you need to use?

I can help you if I have the excerpt otherwise I may give you the wrong answer.

Answer Link

Otras preguntas

A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT 1)25 and 0 2)25 and 25 3)14

in the human body blood as a tissue. The job of the blood is to bring nutrients in oxygen to the different parts of the body and remove any waste or harmful tox

please help me I will be giving a brainliest to the first person to answer

A line between a planet and the sun sweeps out two equal areas at different places as it moves along its orbit. Which factor remains constant as this happens?

How do you solve 3+7×2-18/3=

Roy's Welding common stock sells for $58.49 a share and pays an annual dividend that increases by 1.3 percent annually. The market rate of return on this stock

Where is the Straight of Hormuz? a Between the Red Sea and Gulf of Arden b Between the Persian Gulf and the Gulf of Oman

What is the volume of this cube? Enter your answer as a number only; no units.

An example of epistasis is pigmentation in mice. The wild-type coat color, agouti (AA), is dominant to solid- colored fur (aa). However, a separate gene (C) is

what is the water cycle