aryanamunoz04 aryanamunoz04

14-04-2020
Biology

contestada

A restriction enzyme is coded for: AT!GC

How long would the Base Pair fragments be for this DNA sequence?

AGTCGAGTATATGCATGGCCGCGAT

1)25 and 0
2)25 and 25
3)14 and 11
4)12 and 13

Respuesta :

exspressgirl27oz2xjv exspressgirl27oz2xjv

21-04-2020

Answer: The answer is 4) 12 and 13

Explanation: you count the A and T together, which is 12. Then you count the G and C together, which is 13. I just took a test with this question and got it correct

Answer Link

Otras preguntas

math,the opposite of 10/7

Why the denator in the numerator stay the same

Ana atom of hydrogen and an atom of carbon are

3/4 of students in your classroom listen to rap music only. 1/2 of these students are boys. What fraction of students in your classroom are boys who listen to

which type of plant reproductive cell-spore or gamete- is better adapted for dispersing, or spreading, bryophytes and ferns to other places?

why did the banana go out with the plum?

Can you help please!!!! 12. Carmine has 8 liters of punch for a party. Each glass holds 1/5 liter of punch. How many glasses can Carmine fill with punch? 13.Fou

What countries were affected by the Holocaust?

marge cuts 16 pieces of tape. each piece is 3/8 inches long. how much tape did she use

What is the supplement of 179 angel?