miaxram586 miaxram586

15-12-2017
Biology

contestada

Having two different alleles for a trait is called what?

Respuesta :

animegirl2193oy1dst animegirl2193oy1dst

15-12-2017

its called Heterozygous

Answer Link

Otras preguntas

difference between if then and if then else statement

The price of a sandwich decreases from $8 to $6. What is the percentage decrease in the price of the sandwich?

Marco asked Jolene to help him study for his calculus 101 midterm, but she explained that she was still struggling to understand geometry. He went to the Math T

12345 :- 987 me pueden ayudar con esta division

Can some one help me ASAP and thanks :)

What are the risks of using genetically engineered products in the food supply? Check all that apply. cancer risks unknown consequences possible antibiotic resi

The time needed to complete a final examination in a particular college course is normally distributed with a mean of 79 minutes and a standard deviation of 8 m

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

How is a genesis rock useful to humans?

Kyndal wants to buy a lamp that originally cost $82, but went on sale for 20% off. The store is having an additional sale that is 40% off the sale price. What i