Hernandez5797 Hernandez5797

12-12-2017
Mathematics

contestada

Jashawn wants to make 5 airplanes. He needs 18 centimeters of wood for each propeller. How many centimeters of wood will he use.

Respuesta :

seattlehorse99r seattlehorse99r

13-12-2017

He will use 90 centimeters of wood

Answer Link

Otras preguntas

I need help on these two problems.

What are the roots of x in -10x2 + 12x - 9 = 0?

The prevention of the long term complications associated with poorly treated diabetes mellitus by the tight regulation of blood __________

Identify any solutions to the system given below. 2x + y = 5 3y = 15 - 6x

Given triangle ABC with sides AB = 3x + 4 , BC = 2x + 5 , and AC = 4x , determine the values of x such that triangle ABC exists

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3' a) 5' CTGTATCCCAGACGGATATAACT 3' b) 5' TCAATATACCGTCTGGGTA

In a Mendelian cross of Standard dominance, All of the F1 individuals are _____________________ for the trait being studied.

Find the slope of the line that passes through the point (-2,4) and (-5,-6)

Feeding iron-fortified cereals and foods to children over 6 months of age a. Not recommended b. Recommended

The new militancy and restlessness among many members of the African-American community after 1945 was generated by a. The appointment of Thurgood Marshall, ch