jordanmalach jordanmalach
  • 14-07-2017
  • English
contestada

Why did Shakespeare's nobles speak in lambic pentameter while commoners spoke mainly in blank verse or prose

Respuesta :

JohnLayton
JohnLayton JohnLayton
  • 14-07-2017
Often, nobles such as the Capulets and Montagues spoke in iambic pentameter and commoners spoke in blank verse. This was often done in order to draw attention to the main characters of the play, and to distinguish between those who were 'important,' and those who were peasants/unimportant.

Hope this helps!
Answer Link

Otras preguntas

Alexandra paid \$7$7dollar sign, 7 to park her car for 333 hours at the parking garage. The garage charges an hourly parking rate. Write an equation that shows
The chemical formula for lithium phosphide is Li3P. Which best describes this ionic compound?
An allele that is dominated or covred up by another allele is called what?
Why is inulin administration an effective way of measuring renal clearance rates?
1. Which part of an essay restates the main idea, without simply repeating it, and leaves readers with something memorable to think about? A. The first body pa
Identify the slope and y-intercept of the equation Y=-2/3x+490
Topsoil that washes onto a coral reef _____.
Kennedy's speech is critical of Soviet-backed actions in what country?
1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
PART A. At what point does the tone of “The Fruit Garden Path” change? A. line 5 B. line 8 C. line 9 D. line 11              The Fruit Garden PathThe path r