crystalnoiles8orvivq crystalnoiles8orvivq

13-07-2017
Mathematics

contestada

Determine the type and number of solutions of −4x2 − 3x + 7 = 0

Respuesta :

RickyChen RickyChen

13-07-2017

Since 3^2 - (-4)(7) must be bigger than 0

Then it has two real roots.

Answer Link

Otras preguntas

Nutrition plays a role in ________ of the top ten causes of death in the united states. a. six b. seven c. four d. five e. three

What is the Tone of Icarus and Daedalus?

List the four steps of the written process and explain why each is important

15. Using 1/2-inch EMT and a hand bender, you want to make a bend with a 14-inch stub-up. How far from the end of the conduit should you put the mark that wil

Our eighth-grade science teacher is planning a trip to the science museum, and she showed us the exhibits on the museum website. The first-floor exhibits are i

Joanna has a board that is 6 feet long. She cuts it in to pieces that are each 1/4 foot long. Which equation represents the number of pieces she cut?

A farmer stacks hay bales

the force that one surface exerts on another when two rub against each other ia called

Draw the curved arrow mechanism for the conversion of aniline into benzenediazonium ion, and draw the final product that forms after the benzenediazonium ion is

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg