heethlynn heethlynn
  • 16-02-2022
  • Arts
contestada

Is beethoven symphony number 9 a romantic or classical music

Respuesta :

lonaa lonaa
  • 16-02-2022
Classical, the transitional classical
Answer Link
Аноним Аноним
  • 16-02-2022

Answer:

Classical music

Explanation:

Beethoven's Symphony No. 9 is also known as the 'Choral' Symphony because Beethoven took the highly unorthodox step of writing the fourth movement for four vocal soloists and a chorus, setting parts of Schiller's uplifting poem An Die Freude (Ode To Joy), which has as its theme the universal brotherhood of mankind.

Hope this helped!

brainliest please!

Answer Link

Otras preguntas

Help me please I don’t really get this question only answer if you know this question
What were Augustus accomplishments
2x³ - 21x² - x = 8x(If you find the answer in Decimal, it's wrong.)​
(5, 3) and (5,-9) slope: 30 POINTS
Please help me asappppp
Next, drag the red block back into the water. Hold it underwater, and quickly record the water level before the block rises. Type the correct measurement in the
Are these two triangles similar???????!!!!!!! PLEASE HELP! I WILL GIVE BRAINILST AND MANY POINTS!
If a 78.51 g stone is added to a graduated cylinder, the water level rises from 20 mL to 45 mL. What is the density of the stone?​
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
SOMEBODY PLEASE HELP ME! I DONT UNDERSTAND