25roev05 25roev05
  • 11-02-2022
  • Biology
contestada

What is the mRNA transcript if the complementary DNA is TCTGAG?

Respuesta :

10818570
10818570 10818570
  • 11-02-2022

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

Answer Link

Otras preguntas

what times what equal 16?
The distance from home plate to second base is about 127.3 ft.  1.  How would you find the distance between the bases.2.  Estimate the distance between the base
The distance from home plate to second base is about 127.3 ft.  1.  How would you find the distance between the bases.2.  Estimate the distance between the base
rewrite the expression without using grouping symbols. -6(8+12)
rewrite the expression without using grouping symbols. -6(8+12)
50 is 40% of what number?
Why did the Virginia Company give settlers the right to self-government?
Jamaal buys his clothes at Super Discounts. On Saturday, he bought shoes regularly priced at $40 for 25% off, and a jacket regularly priced at $100 for 30% off.
Mr. Jacob is 55 years old and tony is 7 years old. in how many years will mr. Jacobs be 4 times as old as Tony
do you know 3 prime numbers that equal 32