burekuklejewski burekuklejewski

15-11-2021
Mathematics

contestada

How to solve this question? Adding algebraic fractions

$How to solve this question Adding algebraic fractions class=$

Respuesta :

haydenanzur haydenanzur

15-11-2021

Answer:

it should be 2/12 and 9/11

Step-by-step explanation:

Answer Link

Otras preguntas

If a constant of proportionality is 1/5, what would the new constant of proportionality be if the x and y axes were flipped? (answer asap pls)

Aaron travels 125 miles in 2.5 hours. At this rate, how far will he be able to travel in 6 hours?

Premises is a statement or idea taken to be true and on which an argument or reasoning may be based. O True O False

uh help please for 69 point :)

The perimeter of a rhombus is 60. If the length of its longer diagonal measures 24, the length of the shorter diagonal is

Why is it important to remember Ella Fitzgerald? Write 5 to 6 sentences

Use the Distributive Property to rewrite the expression -3(4 - 6x) in its equivalent form.

i cant write it on here do pls look at the picture i provided

What is the complementary strand of DNA to the one below? AAACCGTATCCGCGGTATATCGCCGGAAT

Someone plz help me giving brainliest