malekamcdermott malekamcdermott

15-11-2021
Mathematics

contestada

Tamara bought a $22 mailbox using a 10% off coupon David bought an identical mailbox for $19.95 at a different store
Which statement is true?

Respuesta :

tiarahcrumbley0524 tiarahcrumbley0524

15-11-2021

Answer:David bought an identical mailbox for $ 19.95 at a different store.

Step-by-step explanation:

David bought an identical mailbox for $ 19.95 at a different store. you can buy a same mailbox but for different prices you have 22 dollars you have a 110 percent off you dont have enough

Answer Link

Otras preguntas

Ayuda por favor no le entiendo a este tema

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

how much does it cost to buy 1500g of cornflakes

Because News Media can shape public opinion it can also have an influence on what policies or laws are created by the government..? True or false

La varilla liviana de la figura 5.12

include all the symptoms that impact humans biologically

Choose the correct homophone to fill in the blank in the sentence below. He has a stomach ache because he ate many blueberries. A. to B. too C. two D. tew

The following passage appears on a website: Cormorants may look like an average bird, but they are actually skilled divers. These water birds can hold their bre

I NEED HELP!!! If bacterial cells which can do both anaerobic and aerobic respiration are put in separate containers of oxygen and no oxygen which container wou

principles of science