crystalgolder crystalgolder
  • 15-07-2021
  • Mathematics
contestada

i need help. i don't understand this at all.

i need help i dont understand this at all class=

Respuesta :

limichael2005 limichael2005
  • 15-07-2021

Answer:

Step-by-step explanation:

If this is in terms of angles, 4x+6 must be equal to 90 since it is half of the angle produced by a line (180°) So solving for 4x+6=90, x=21

Answer Link
kingelijah86ke kingelijah86ke
  • 15-07-2021
Yes that’s the answer
Answer Link

Otras preguntas

For which value of c will the equation 2x-5=2x-c have an infinite number of solutions? 3 4 5 6
Help me pleasee. Solve the system by substitution
similarities between peer teaching and micro teaching​
what is 6+89-34X12 CASLAN
1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
i need helppppppppp​
mia i was there for u all the time i literally helped u and ur mom pay off stuff and you tell me you dont wanna be friends anymore cus im black? thats so disgus
Elizabeth is building a wooden deck. She has a plank of wood that is 5.2 meters long. She needs to cut the plank into 1.3 meter long pieces. 5.2 meters How many
Uhhh can someone help me out? Please?
how many bits would be needed if there is 15 students in the class