princess1112 princess1112

15-07-2021
Mathematics

contestada

Simplify the attached equation:

4[tex]4\sqrt{6x^{3} }y^{5} . -3\sqrt{24x^{7} } y[/tex]

Simplify the attached equation 4tex4sqrt6x3 y5 3sqrt24x7 ytex class=

Respuesta :

JohnBsc23 JohnBsc23

15-07-2021

Respuesta correctas espero q te ayude

Ver imagen JohnBsc23

Answer Link

Otras preguntas

i need help please help me

Whereas _____ memory involves the conscious recollection of facts and events, ___________ memory involves nonconscious knowledge derived from past experience?

An animal shelter has 40 puppies. If the puppies are 32% of the total dog and cat population, how many dogs and cats are in the animal shelter?

Please help solve algebra question

Suppose that two cards are randomly selected from a standard 52-card deck. (a) what is the probability that the first card is a club and the second card is a

Mrs. mcglashan is making paint for her class

Read the passage and complete the sentences that follow. Mrs. Dalloway by Virginia Woolf (excerpt) Septimus Warren Smith, aged about thirty, pale-faced, beak-n

"it is time for you to get off your computer and come downstairs to eat dinner with the family" is an example of the type of discipline called a(n)

An ____ or scar appears at the base of the petiole where the petiole attaches to the stem

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg