aaronrichardson1122 aaronrichardson1122

12-07-2021
Physics

contestada

Need help! Need help! Need help! Need help! Need help! Need help!

Need help Need help Need help Need help Need help Need help class=

Respuesta :

roojtaraniraula roojtaraniraula

12-07-2021

Answer:

i can help you i know this answer

Answer Link

140130561 140130561

20-01-2022

Answer: the side two are 50 then the other two are 140 i thank

Explanation:

Answer Link

Otras preguntas

I need help with this question.

[tex]−20x+40=−20x+20[/tex]

The integer 5 makes which of the following equation false

Examine the social, political, and economic impact of the Civil War on the North and the South.

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

create a entertainment speech about friendship 2 stanza

Find sin(17π/12) exactly. I think it has to do something with splitting 17/12 into 1/3 + 1/4 + 5/6 and using the sin/cos angle sum identities. Though when I tri

Refer to the Newsela article, "Shelter Dog Protects Owner with Epilepsy." How does this article develop the idea in the beginning that Toby might not be right f

Writing equations of lines of best fit

20 points to whoever answers this asap <3 Joe and Andrew shot baskets in a school fair. Joe made 9 baskets, which is 2 baskets more than Andrew. Supply the c