RamenDonkey RamenDonkey

14-04-2021
Biology

contestada

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Respuesta :

addysenseheult addysenseheult

14-04-2021

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

Answer Link

Otras preguntas

HELP ME PLEASE!! Solve for x. Show your work. -1/2-x < -12

Spencer worked out for 232 1/2 minutes in the last five days. If he worked out for the same number of minutes each day, how many minutes did he work out each da

In paragraphs 9-12, how does the description of the setting contribute to the mood of thestory? What does this tell you about the town's attitude toward the ann

a -cell can present an anitgen to -cell

I don’t understand how to get the answer

According to this author, were the effects of the Industrial Revolution positive or negative ?

Find the approximate solution of the given system of equations. 8x + 3y = 9 3x - 5y = 20 a. (3.36, -1.99) b. (-1.11, 2.79) C. (0,-1.99) d. (3.36, 2.79)

When light hits the water droplets in a cloud, the cloud appears white. The light waves are being: A. scattered. B. intensified. C. absorbed. D. consoli

What is the relationship between exposure to a virus and developing an immunity to it? Cite evidence from the text to support your response. (From commonlit)

The measure of ZPQR is 45°. The length of radius QR is 6 inches. What is the area of sector PQR? Use 3.14 for T. Q Note: Picture is not drawn to scale.