lauraisaqr lauraisaqr
  • 12-03-2021
  • Mathematics
contestada

Is this a function? Why?

Is this a function Why class=

Respuesta :

karenbbakerr karenbbakerr
  • 12-03-2021
no i think don’t trust me
Answer Link

Otras preguntas

Sophia is buying party favors "f". She has a budget of $2.75 a person for 6 people. How much can Sophia spend on party favors? Write and solve a division equati
the price of mailing a small package is $0.32 for the first ounce and $0.21 for each additional ounce.simone paid $1.16 to mail her package .how much did it wei
what led to huge economic growth in the 1920s?
Which excerpt from Jack London's "To Build a Fire" best expresses the dominance of nature that is part of the Naturalist perspective? A. "He knew that
A bag holds 2 yellow, 1 green, and 2 red marbles. if you were to draw a marble from the bag 150 times, and replace it after each draw, how many yellow marbles w
What is the result of adding -2.9+6.8 and 4.4 - 7.3
Which of the following writing techniques are used in expository writing?
(07.02 HC) A certain type of heart-muscle disease thickens the heart muscle so that the heart chambers shrink in size. How would this disease affect a person ov
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
How do you express this in scientific notation?