themisterious621 themisterious621
  • 12-03-2021
  • Mathematics
contestada

what is the surface area of a rectangular prism that is 12cm by 3cm by 5cm?

Respuesta :

maheeniqbal
maheeniqbal maheeniqbal
  • 12-03-2021
A = 2lw + 2lh + 2hw
A = 2(12)(3) + 2(12)(5) + 2(5)(3)
A = 72 + 120 + 30
A = 222 cm squared

Hope this helps!! :)
Answer Link

Otras preguntas

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
how do U do a 3D model of a project on unit 6 vocabulary for science
The paragraphs in an essay should always be written in complete sentences true or false
Project on topic snake poem of 10 class c.bse pics
Which is the best version of this sentence? A) Elizabeth buys all the ingredients and then prepared the meal for her grandmother's 90th birthday party. B) Eliz
the construction of what led to trade expansion in the midwest
what is the value of the following expression? 2×{6+ [12÷(3+1)]} - 1
Which of these transitions would be used to build suspense? A. By the way B. Over there C. In comparison D. Little by little
An artistic person may be interested in a career in arts, audio/video technology, and communications. True Or False
colonial times job's