aubreelang aubreelang

13-02-2021
Chemistry

contestada

A(n)_______ contains two or more substances that are not chemically combined. (pic down below)

An contains two or more substances that are not chemically combined pic down below class=

Respuesta :

abigail3568 abigail3568

13-02-2021

Mixture

Hope this helps!!!!

Answer Link

iStalingrad iStalingrad

13-02-2021

Answer: Mixture

Reason: It is not elements because an element is a single atom. It is not compound because in a compound two elements are chemically combined.

Answer Link

Otras preguntas

If the diameter is 26 inches, what is the radius

A freezer can be bought on hire purchase by making a deposit of 15% of the cash price which is $2 975. Interest which is equivalent to 20% of the outstanding ba

Describe a private judge

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAAT

Find the area of this triangle. PLS HELPP!!

To sell an item in online aunctio, WebAunctions charges a $5 listing fee plus 10% of the final selling price. AunctionsOnline charges a 3$ listing fee plus 15%

Given the information in the sentence, identify what was most likely true about Irving at that time. Choose two options.

What is the surface area of the sphere in terms of pie? (Answer only with right answers no links or you’ll be reported)

I am failing a class and my mom is having a conference with the teacher who is failing me but it's partially my fault because i didn't submit some assignments!

Please answer. Thank you!