jamielovexo6379 jamielovexo6379
  • 11-02-2021
  • Arts
contestada

Maria walks 1 712 miles. Joan walks 2 12 miles. How can you find how much farther Joan walks to school than Maria?

Respuesta :

topeadeniran2 topeadeniran2
  • 15-02-2021

Answer: 11/12 miles

Explanation:

From the question, we are informed that Maria walks 1 7/12 miles and that Joan walks 2 1/2 miles. For us to solve the question, we have to calculate the difference between their miles walked. This will be:

= 2 1/2 - 1 7/12

= 2 6/12 - 1 7/12

= 11/12 miles

The answer is 11/12 miles

Answer Link

Otras preguntas

A carnival game has 160 rubber ducks floating in a pool. The person playing the game takes out one duck and looks at it. If there’s a red mark on the bottom of
Next school year 4 out of every 9 students plan to take an elective computer course if there are 2664 students at the high school how many computer students sho
Thermoplastics can be made to act more like thermosets by a process called cross-linking ture or false?
true or false eukaryotes are much smaller than prokaryotes
Under which type of change would more organisms be able to survive and why?
what is the coefficient of the term x^7y in the expansion of (x+y)^8
Why people especially the illiterate still gets infected in HIV and AIDS?
What is the greatest fraction you can make using the digits 4, 7, and 9?
There are 250 degrees in the sum of the interior angles of a polygon. Always, sometimes, never
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the