jojogut09 jojogut09
  • 15-01-2021
  • Mathematics
contestada

I need help with math pls

I need help with math pls class=

Respuesta :

02875 02875
  • 15-01-2021

The answer is 6

Explanation:

Answer Link

Otras preguntas

Why did the USSR adopt atheism as an official state policy? to eliminate one potential source of conflict and opposition because Lenin did not bel
Which of the following is part of North America? 1 U.S.A 2 Iceland 3 Canada 4 Japanese Islands 5 Argentina 6 Caribbean Islands 7 Greenland 8 Mexico 9 Antarctica
A mirror works on the principle of A. refraction B.reflection,C.dispersion? and a lens works on the principle of A. refraction B.reflection C. dispersion?
Look at the graph of the function y = 5x. Which statement is true?
An advantage of sexual reproduction over asexual reproduction is that sexual reproduction
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
List the following in order from largest to smallest: organisms, organs, tissues, cells cells, organs, tissues, organisms cells, tissues, organs, organisms
If N is a negative number, then what is the distance of N from 0?
Geometry help please! ty Can you explain to me how to find the area of rectangles and triangles on a coordinate plane? Images below...
what compatible number can you use to estimate 803÷86