713sergio 713sergio

15-12-2020
Biology

contestada

If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

Respuesta :

peppapig200 peppapig200

15-12-2020

UACCGCUCCGCCGCUCGACAAUACC

Answer Link

Otras preguntas

Jethro wants a swimming pool in his backyard, so he digs a rectangular hole with dimensions 40 feet long, 20 feet wide, and 5 feet deep. How many cubic feet of

The world population was 4.2 billion people in 1982. the population in 1999 reached 6 billion find the percent of change from 1982 to 1999

Your teacher gives you a task in science class. You must decide which of the five samples you are given are alive or were once alive. One specimen is a crusty g

How are voting amendments changed American soicty?

i need help! I think I know what to do, but I'm not, like, 100% certain, so if anyone can explain to me how to do this that would be SUPER! (#1, btw, ik how to

Can someone help me find the area of this trapezoid i'm very lost

round each number to the nearest tens,hundreds, and thousands a b and c

Which expression represents the sum of (2x- 5y) and (x+y)

A file cabinet top is 5/7 yd by 6/5 yd find the area

What is the basic source of chemical energy for muscles?