beltranchristopher48 beltranchristopher48

14-12-2020
Business

contestada

Most licensed architects are members of which association? A. ACSA B. AIA C. NAAB D. NCARB E. NVOB

Respuesta :

fatcats234 fatcats234

14-12-2020

Answer: It is B. AlA

Explanation:ALA is open to all architects and professions related to architecture. Our members hold individual memberships and specialize in all types of architecture.

Answer Link

Otras preguntas

pensez vous qu'il est difficile pour un homme d'assumer sa compagne qui soit son égale

help please, the question in the picture

Suppose you earned a $710,000 bonus this year and invested it at 8.25% per year. how much could you withdraw at the end of each of the next 20 years? select th

Your friend offers to pay you an annuity of $9,200 at the end of each year for 3 years in return for cash today. You could earn 5-5% on your Select the correct

Last year, Amy deposited $1000 into an account that paid 2% interest per year and $3000 into an account that paid 7% interest per year. No withdrawals were made

this bohr model is showing what element

Limericks about Marbury vs Madison

A commuter plane can carry 50 people per trip. At least How many times does the plane have to fly in order to carry 25,000 people? Identify the variable and ans

The Patient Protection and Affordable Care Act will impact many areas of health care, discuss the implications you anticipate for you, your family, and your fel

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG