baseetah baseetah

12-12-2020
History

contestada

What majority of Congress does it take to amend the Constitution?
13
214
3/5
2/3

Respuesta :

iknowyourecrying iknowyourecrying

12-12-2020

i think it was 2/3 cdhrehsgdghef

Answer Link

Otras preguntas

has an opposite effect to that of harmony in art

Think back to the example in the Warm-Up: A business owner wants to open a restaurant, but many residents do not want a business that is open late at night near

Who uses the river nile

Identify the following. The long, long train traveling to Canada, winding through the Rockies. fragment simple sentence complex sentence

what compatible number can you use to estimate 803÷86

Jamie purchased a DVD that was on sale for 15% off. The sales tax in her county is 5%. Let y represent the original price of the DVD. Write an expression that c

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3

What is 10 blankets plus 56 more blankets X2

find a third degree polynomial

From your understanding, why was Nazism popular among Germans, especially in the beginning? Select all that apply. The democrats ignored the need for social re