i1nizam1i
i1nizam1i i1nizam1i
  • 13-10-2020
  • Biology
contestada

DNA: TAC-GGC-ATA-GCA-TTT-CAC-TAA



What is the complementary DNA sequence for the DNA strand above?

DNA TACGGCATAGCATTTCACTAA What is the complementary DNA sequence for the DNA strand above class=

Respuesta :

KurdishPotato
KurdishPotato KurdishPotato
  • 13-10-2020

Answer:

Option D)

Explanation:

In the DNA strand A comes accross Tç and C comes across G

The option justifies this rule is D)

Answer Link
87187 87187
  • 13-10-2020

The picture doesn't work for me.. sorrry

Answer Link

Otras preguntas

As a student in the Principles of Management class of Ama Ghana University, you are expected to have experiential knowledge so that you can be able to solve rea
find the missing lenghts of the sides
i really need the answer for this and how you got it please!
A number, x, rounded to 1 significant figure is 200Write down the error interval for x.​
Can y’all help me with this
Which of the following describes the difference between drama and other prose and poetry? Unlike other literary genres, drama is written to be performed. Dram
Use given triangle to fill in the blank. sin B =
Which expression is equivalent ? LOOK AT THE PICTURE
The Homestead Act (1862) attempted to promote development of western lands by A.removing all restrictions on immigration B.creating a system of dams for crop ir
describe the postwar economic recovery of Japan and European nations.