i1nizam1i i1nizam1i

13-10-2020
Biology

contestada

DNA: TAC-GGC-ATA-GCA-TTT-CAC-TAA

What is the corresponding RNA sequence for the DNA strand above?

DNA TACGGCATAGCATTTCACTAA What is the corresponding RNA sequence for the DNA strand above class=

Respuesta :

13-10-2020

Answer:

Changing G to C

C to G

A to U

and T to A, the answer will be C

Answer Link

Otras preguntas

Please help I need an answer really bad

If the pope wanted to punish leader in medieval Europe , what options were available to him? A. Lay investiture and the clergy b. Warfare and trade disruption c

Jenn twirled around in from of the mirror at the department store, her purple prom dress dancing along with her. She had found the perfect dress. Now she just h

HURRY ITS TIMED I WILL GIVE BRAINLIEST Why do some people consider the way the media cover candidates for public office bad for democracy? (A).People tend to v

fill in the blanks with the correct form of teners

What does earth plates do during a earthquake

Write an equation of the line that passes through (-3,3) and is perpendicular to the line 2y=8x-6

name the four physical properties of metals

For problems that involve an object accelerating along an inclined plane, how can the weight be used to determine the force component that causes motion? The we

Find the measure of the missing value in the pair of similar polygons. (Shapes not drawn to scale.) 17.5 ft 25 ft 25 ft w 18 ft