DesireeBanks DesireeBanks

15-09-2016
Mathematics

contestada

in 217,534,896,000,000 which digit is in the ten-billions place

Respuesta :

HayHayABA26 HayHayABA26

15-09-2016

3 is the 10 billions place

Answer Link

Otras preguntas

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

A molecule that functions in maintaining and/ or reproducing life is called a what

hey can someonehelp measap plz dont guess

Question 4 Unsaved Fifty-eight boys were asked if they play football and/or baseball. Thirty-one of them said they do not play baseball. Sixteen of them said

Solve for m -20+14m=10m+16

why are organisms classified?

Mesopotamia is the ancient origin point for which of the following major religions? A.) Judaism B.) Hinduism C.) Utilitarianism D.) The Vedic religion

Which term best describes traits that are found on the x chromosome but not on the y chromosome?

Would someone Please answer this question please will be thanked and also will pick brainly!! (please be honest)

The problem mass-society theory sees with the expansion of bureaucracy and the state is that