estefanitacrlop2006 estefanitacrlop2006

13-05-2020
Social Studies

contestada

Brad puts 2 tomatoes in each salad. There are 4 salads how many tomatoes does he use

Respuesta :

seyqwan04 seyqwan04

13-05-2020

Answer:

2 cubes each

Explanation:

Brad puts 2 tomatoes in each salad. There are 4 salads how many tomatoes does he use so you will need to subtract by cutting them in halves

Answer Link

Otras preguntas

A map of three public schools was created using a coordinate plane where the origin represents the center of the town. Euclid Elementary School is graphed at (−

for every 3 girls taking classes at a martial arts school there are 4 boys who are taking classes. suppose there are 236 boys taking classes at the school. writ

when a roller coaster gets to the bottom of a descent, describe the energy transfers and changes to energy stores that happen if: a) the brakes are applied b) i

The graph at left in the tD, D-plane shows the relationship between t, the time since January 1st in days, and D, the distance between the Earth and the Sun at

Find x and y please 10 points

Can someone check for any mistakes in my spelling

what is a mass of 400ml of liquid that has a density of 4g/ml

Excluding air pressure, there is how many force or force(s) acting on a book lying at rest on a tabletop?

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

What does semiskilled mean? / In I-ready