charlizelanae charlizelanae

13-03-2020
History

contestada

Which of these was the least important aspect of imperialism in the period following European industrialization

Respuesta :

hither5466346e hither5466346e

13-03-2020

Answer:

The state sponsorship of Christian mission.

Explanation:

Answer Link

Otras preguntas

Ramon bikes every afternoon. He travels 4 1/4 miles in 1/4 hour. At what rate dies Ramon ride his bike in miles per hour

Please help me!!!! What is one goal for the future to help with climate change?

According to ___________, quantitative changes in an infant's abilities to organize and manipulate information represent the hallmarks of cognitive development.

You asked amusement park visitors the question “How many times did you ride the Ferris wheel today?” as they left the park. Four people said they rode a Ferris

who was the leader of Italy during the second world war?

Which of the following values of x satisfy the equation 3x^2-8x+4=0

According to the assumptions upon which most reaction mechanisms are based, collisions must occur in order for a chemical reaction to occur, but: a. energy is d

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg

Francis has 6 chocolate bars.he gives one to John and one to Chester. he keeps the rest for him.what fraction of the chocolate bars did he give away?

Which one is not a characteristics of normal urine- a.yellow color b.presence of electrolytes c.ph 4.5-8.0 d.glycosuria e.no leukocytes?