farhiyonh farhiyonh
  • 11-02-2020
  • Arts
contestada

help me describe an art image

Respuesta :

alissadance2003
alissadance2003 alissadance2003
  • 11-02-2020
Describe the lines, colors, values , shapes, textures, space and movement. Sorry if this is not what you meant but i hope this helped i. some way!
Answer Link

Otras preguntas

is this correct please dont randomly answer. but answer if u know​
What are the growth/decay factors and rates for the following functions? a. y=1000(1.03)x b. f(x)=200(0.8)x
what is -2.4x + 9 + 8x + 4.2 = 58
Identify each angle as either acute, obtuse, or right angle and estimate the measure of each angle.
The list below displays the number of different burgers sold at Joe's restaurant during one shift. . Cheese: 10 Double Meat: 6 Triple Meat: 5 Jalapeno: 4 If thi
Which of these might describe expenses for a student? Select all that apply. donations food shoes allowance savings gift received
What is a statement of a metaphore A. She was busy as a bee. B. She has a heart of stones. C. She is an uncaring person. D. His room was like a prison
do you consider President Andrew Jackson to be a Monarch or a President in a Democracy?
Find the sentence in which the bold-faced is used incorrectly.
what is the mRNA in TACCGGATGCCAGATCAAATC?