victorialovelock1219 victorialovelock1219
  • 14-01-2020
  • Mathematics
contestada

Evaluate 10x+18 when x=5

Respuesta :

BubAakash121 BubAakash121
  • 14-01-2020
The answer is 68 because 10 multiplied by 5 is 50 plus 18 is 68
Answer Link

Otras preguntas

where do i plot (7,2) on a graph?
Where is the rhetorical in this sentence? Chippers are the crispiest, crunchiest, and most delicious brand of chips you will ever taste
PLEASE HELPPPPPPPPPPPP
1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Create a program to determine the largest and smallest number out of 15 numbers entered (numbers entered one at a time). This should be done in a function using
A car is traveling at a constant speed of 60km/h but then changes lanes. Even traveling at a constant speed, the car's velocity is changing. Explain
plz help me its easy (: i give brainliest (:
What would have happened if Missouri had joined the Union as a slave state? 1. States in the North would have been forced to legalize slavery. 2. No other terri
Please help! Freshman in high-school Algebra 1​
a line passes through the point (6,-6) and is parallel to the line with the equation y=-5x+8 ... what’s the slope?