ajanae97
ajanae97 ajanae97
  • 15-12-2018
  • Mathematics
contestada

Help me with these 2 questions

Help me with these 2 questions class=

Respuesta :

ttsanginthirath09 ttsanginthirath09
  • 19-02-2019

Answer:

A & B

Step-by-step explanation:

Answer Link

Otras preguntas

Pleaaaseee helpppppp
The United States often achieves its foreign policy goals by: A. refusing to participate in any international organizations. B. placing strict limits on the pow
Subject: Science Here is a model of the Earth - Sun system at a certain point in Earth's orbit around the sun. According to the model, Which two points on Earth
Hey I'm Chloe Can you Help, Thank you. What famous actress died in 2013?
What is the complementary strand of DNA to the one below? AAACCGTATCCGCGGTATATCGCCGGAAT
What is the answer 7(2m+5)​
PLEASE HELP! I'm failing Math and I need to get a good grade on the test in order for me to pass the grade ! Thank you for helping me !
Which Mesopotamian ruler was responsible for creating a legal code (lats) and displaying those laws in public to see? A. Sin-Muballit B. Sargon the Great C. Gil
Solve the system of equations y=4x+1 y=x^2+2x-2 A. (-3,-13) and (1,3) B. (-3,13) and (1,-3) C. (-1,3) and (-3,13) D. (-1,-3) and (3,13)
Help please Marking brainiest