jazzyfaye01 jazzyfaye01
  • 12-07-2018
  • Mathematics
contestada

caculate the mass of a liquid with a density of 2.5/mL and a volume of 15 mL

Respuesta :

vasua vasua
  • 12-07-2018
d=m/v
d=2.5
m=d*v
m=2.5*15
m=37.5g
Answer Link

Otras preguntas

solve for x: x-2/x+4=x+2/x+12 help please
what is the simplest form of 6/8
A plant uses energy from the Sun to make food. What kind of energy transformation is this? A. mechanical energy to chemical energy B. light energy to mech
What is the axis of symmsymmiof y=2(x+1)^2
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
Based on your knowledge of word parts, complete the sentence with the correct word. Sam had to mix __________ parts of the two chemicals for the experiment.
Cady's cats often share a carton of cat milk. Sammy always drinks 1/3 of the carton, tommy drinks 5/12 of the carton and Suzi drinks 1/6 of the carton . What fr
What can increase a person’s chance of getting cancer? A) being born with certain genes B) avoiding tobacco smoke C) staying out of the sun D) limiting exposure
Conrad explores the effects of evil and ignorance in humanity primarily by delving into various connotations of a single concept. This provides the best exampl
Science in light energy