mahletaman12 mahletaman12

15-01-2023
Physics

contestada

1. Helium gas is cooled from 20 °C to 10 °C by expanding from 40 atm to 1 atm. If there is 1.4 mol of helium,
(a) What is the final volume of helium?
(b) What is the change in internal energy?

Respuesta :

Otras preguntas

how many t i k t o k followers do i have alexaasalvatore ill give brainliest

Gabriel and his friend found a piece of metal which they want to identify.Here is what they figure out so far: Mass of this metal is 50 g Volume of this metal i

Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t

Why did the louisana purchase happen

I NEED HELPPPP ASAPPP PLEASE HELP MEEEE I WILL GIVE BRAINLY AND 20 POINTS!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Which inequality is true? A. n+ 7 < 10 B

here's this idk its math ig

What is the kinetic energy of a toy truck with a mass of 0.75 kg and a velocity of 4 m/s

I live in a big city neighborhood _________ without a single bathroom. What is supposed to be in the blank?

Hey make this stuff free

Write the correct adjective in Spanish 1. Miguel y Juan son unos chicos____(intelligence). 2.Marcos y yo somos______(excelente) en la clase de arte. 3. El Chico