fartmcfart fartmcfart

16-12-2022
Mathematics

contestada

Find the distance between the points (6.6,7.9) and (6.6, 4.7).

Respuesta :

Otras preguntas

What hormone stimulates the release of aldosterone by the adrenal cortex and constricts the blood vessels?

Best on the character of Rosa what can the reader infer regarding daughters unstated meaning

Which table shows the function y = -2x + 4? A) x y 0 4 1 2 2 0 B) x y 1 25 2 26 3 27 C) x y 0 -4 1 -2 2 0 D) x y -1 6 -2 8 -3 12

Which monomials are factors of 14xy^4

Complete the solution of the equation. find the value of y when x equals -14 -2x + 5y = 8

The situation analysis of an advertising plan includes historical context as well as evaluation of the industry, the market, and the competition.

Define 1. Larynx 2. Trachea 3.Bronchi 4. Alveoli

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

Solve: if ,A= 1, B= 2, C= 3. 144, 13 5. 15 14, 19 14 1 16 3 8 1 20, @, 20 8 5 1 12 4 10 11 5 25 5 19 3 15=??? Hint; 144= the word, "add".

why are organisms classified?